Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NrtR in Variovorax paradoxus S110

Properties
Regulator type: Transcription factor
TF locus tag: Vapar_6281
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Comamonadaceae
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -61
Score: 6
Sequence: ATGGTTGTACAGTGCAACCAA
Position: -38
Score: 6.2
Sequence: AGAGTTGCACAGTACAACTAA
Locus tag: Vapar_6282
Name: pncA
Funciton: Nicotinamidase (EC 3.5.1.19)
Locus tag: Vapar_6283
Name: pncB
Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Locus tag: Vapar_6284
Name: nadE
Funciton: NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase
Locus tag: Vapar_6285
Name: nadM
Funciton: Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
pncA
Nicotinamidase (EC 3.5.1.19)
pncB
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
nadE
NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase
nadM
Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)

Position: -41
Score: 6
Sequence: AGAGTTGTTCTGTACAACCCA
Locus tag: Vapar_6281
Name: nrtR
Funciton: Nudix-like transcriptional regulator NrtR
nrtR
Nudix-like transcriptional regulator NrtR
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD