Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NrtR in Delftia acidovorans SPH-1

Properties
Regulator type: Transcription factor
TF locus tag: Daci_5757
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Comamonadaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -58
Score: 5.8
Sequence: TAAGTTGCACTATGCAACCCA
Position: -35
Score: 6
Sequence: CGAGTTGTACAGAACAACTTA
Locus tag: Daci_5758
Name: nrtX
Funciton: NrtR-regulated hypothetical OrfX, Band 7 protein domain
Locus tag: Daci_5759
Name: nrtY
Funciton: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
nrtX
NrtR-regulated hypothetical OrfX, Band 7 protein domain
nrtY
NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain

Position: -74
Score: 5.7
Sequence: TAAGTTGTTCTGTACAACTCG
Position: -51
Score: 6
Sequence: TGGGTTGCATAGTGCAACTTA
Locus tag: Daci_5757
Name: nrtR
Funciton: Nudix-like transcriptional regulator NrtR
nrtR
Nudix-like transcriptional regulator NrtR
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD