Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NrtR in Acinetobacter baumannii AB0057

Properties
Regulator type: Transcription factor
TF locus tag: AB57_2113
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Moraxellaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -58
Score: 5.8
Sequence: ATAGTGGCTTTGTGCCACTAT
Locus tag: AB57_2115
Name: prs
Funciton: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
Locus tag: AB57_2114
Name: nadV
Funciton: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
Locus tag: AB57_2113
Name: nrtR
Funciton: Nudix-related transcriptional regulator NrtR
prs
Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
nadV
Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
nrtR
Nudix-related transcriptional regulator NrtR
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD