Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NadQ in Rhodopseudomonas palustris CGA009

Properties
Regulator type: Transcription factor
TF locus tag: RPA1063
Regulator family: NadQ
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector:
Regulog: NadQ - Rhizobiales
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -186
Score: 5.9
Sequence: TTATGCTCTGAATGAGGATAA
Position: -48
Score: 6.3
Sequence: ATATGCTCAAACTGAGTATAT
Locus tag: RPA1055
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: RPA1054
Name: nadB
Funciton: L-aspartate oxidase (EC 1.4.3.16)
Locus tag: RPA1053
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
nadA
Quinolinate synthetase (EC 4.1.99.-)
nadB
L-aspartate oxidase (EC 1.4.3.16)
nadC
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD