Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NadQ in Mesorhizobium loti MAFF303099

Properties
Regulator type: Transcription factor
TF locus tag: mll9106, mll5836
Regulator family: NadQ
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector:
Regulog: NadQ - Rhizobiales
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -58
Score: 5.2
Sequence: TTATAGTCACAACGATTATAT
Position: -32
Score: 5.3
Sequence: TTATAATCAGATGGACTATAA
Locus tag: mll5835
Name: nadA1
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: mll5834
Name: nadB1
Funciton: L-aspartate oxidase (EC 1.4.3.16)
Locus tag: mll5833
Name: nadC1
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
nadA1
Quinolinate synthetase (EC 4.1.99.-)
nadB1
L-aspartate oxidase (EC 1.4.3.16)
nadC1
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Position: -58
Score: 5.3
Sequence: TTATAGTCACAAAGATTATAA
Position: -32
Score: 5.1
Sequence: TTATAATCGTATAGACTATAA
Locus tag: mll9104
Name: nadA2
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: mll9103
Name: nadB2
Funciton: L-aspartate oxidase (EC 1.4.3.16)
Locus tag: mll9102
Name: nadC2
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
nadA2
Quinolinate synthetase (EC 4.1.99.-)
nadB2
L-aspartate oxidase (EC 1.4.3.16)
nadC2
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD