Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NadQ in Comamonas testosteroni KF-1

Properties
Regulator type: Transcription factor
TF locus tag: CtesDRAFT_2978
Regulator family: NadQ
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector:
Regulog: NadQ - Comamonadaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -91
Score: 5.7
Sequence: TAATGCTCAGATTTAGCATAA
Position: -11
Score: 5.8
Sequence: AAATACTCAAAATGAGCATTA
Locus tag: CtesDRAFT_2977
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Locus tag: CtesDRAFT_3519
Name: null
Funciton: Uncharacterized protein UPF0065
nadC
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Uncharacterized protein UPF0065

Position: -52
Score: 6.2
Sequence: TAATACTCAGATTGAGTATAA
Locus tag: CtesDRAFT_2575
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: CtesDRAFT_2576
Name: nadB
Funciton: L-aspartate oxidase (EC 1.4.3.16)
nadA
Quinolinate synthetase (EC 4.1.99.-)
nadB
L-aspartate oxidase (EC 1.4.3.16)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD