Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NadQ in Psychrobacter arcticum 273-4

Properties
Regulator type: Transcription factor
TF locus tag: Psyc_0633
Regulator family: NadQ
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector:
Regulog: NadQ - Moraxellaceae
Statistics of regulated genes:
- Genes 4
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -107
Score: 6.8
Sequence: TTATGCTCAAAATGAGCATAA
Locus tag: Psyc_0632
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: Psyc_0631
Name: nadB
Funciton: L-aspartate oxidase (EC 1.4.3.16)
nadA
Quinolinate synthetase (EC 4.1.99.-)
nadB
L-aspartate oxidase (EC 1.4.3.16)

Position: -186
Score: 6.8
Sequence: TTATGCTCATTTTGAGCATAA
Locus tag: Psyc_0633
Name: nadQ
Funciton: Transcriptional regulator of NAD metabolism, COG4111 family
nadQ
Transcriptional regulator of NAD metabolism, COG4111 family

Position: -83
Score: 6.2
Sequence: TTATGCTCATTTTGAGTTTAA
Locus tag: Psyc_0634
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
nadC
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD