Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SmtB in Synechocystis sp. PCC 6803

Properties
Regulator type: Transcription factor
TF locus tag: sll0792
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Regulog: SmtB - Cyanobacteria
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -97
Score: 6.5
Sequence: AACACCTGAAGATATGCTCAGATATT
Locus tag: sll0792
Name: smtB
Funciton: Zinc stress transcriptional regulator, ArsR family
smtB
Zinc stress transcriptional regulator, ArsR family

Position: -80
Score: 6.5
Sequence: AATATCTGAGCATATCTTCAGGTGTT
Locus tag: slr0798
Name: ziaA
Funciton: Zinc-transporting ATPase (EC 3.6.3.5) (Zn(2 )-translocating P-type ATPase)
ziaA
Zinc-transporting ATPase (EC 3.6.3.5) (Zn(2 )-translocating P-type ATPase)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD