Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SmtB in Synechococcus elongatus PCC 7942

Properties
Regulator type: Transcription factor
TF locus tag: Synpcc7942_1291
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Regulog: SmtB - Cyanobacteria
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -74
Score: 6.3
Sequence: CATACCTGAATCAAGATTCAGATGTT
Position: -42
Score: 7.1
Sequence: AACACATGAACAGTTATTCAGATATT
Locus tag: Synpcc7942_1290
Name: smtA
Funciton: Metallothionein
smtA
Metallothionein

Position: -84
Score: 7.1
Sequence: AATATCTGAATAACTGTTCATGTGTT
Position: -52
Score: 6.3
Sequence: AACATCTGAATCTTGATTCAGGTATG
Locus tag: Synpcc7942_1291
Name: smtB
Funciton: Zinc stress transcriptional regulator, ArsR family
smtB
Zinc stress transcriptional regulator, ArsR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD