Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SmtB in Nostoc sp. PCC 7120

Properties
Regulator type: Transcription factor
TF locus tag: alr0831
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Regulog: SmtB - Cyanobacteria
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -85
Score: 6.4
Sequence: AACAATTGAACAACTATTCAATTGTA
Locus tag: all7621 (deprecated)
Name: smtB
Funciton: Zinc stress transcriptional regulator, ArsR family
smtB
Zinc stress transcriptional regulator, ArsR family

Position: 13
Score: 6.4
Sequence: TACAATTGAATAGTTGTTCAATTGTT
Locus tag: alr7622 (deprecated)
Name: alr7622
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
alr7622
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD