Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SmtB in Cyanothece sp. PCC 8801

Properties
Regulator type: Transcription factor
TF locus tag: PCC8801_0860
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Regulog: SmtB - Cyanobacteria
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -71
Score: 6.9
Sequence: AATATCTGAATACCTGTTCAGATGTT
Locus tag: PCC8801_0861
Name: smtA
Funciton: Metallothionein
smtA
Metallothionein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD