Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PirR in Synechocystis sp. PCC 6803

Properties
Regulator type: Transcription factor
TF locus tag: slr1871
Regulator family: LysR
Regulation mode: repressor
Biological process: Salt stress response
Effector:
Regulog: PirR - Cyanobacteria
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -118
Score: 5.3
Sequence: TTGTCCCTATTTTGGATGCAA
Position: -77
Score: 5
Sequence: TTGTCTTTATTGGGGATGCAA
Locus tag: sll1773
Name: pirA
Funciton: Pirin-like protein
pirA
Pirin-like protein

Position: -73
Score: 5
Sequence: TTGCATCCCCAATAAAGACAA
Position: -32
Score: 5.3
Sequence: TTGCATCCAAAATAGGGACAA
Locus tag: slr1871
Name: pirR
Funciton: Salt stress response transcriptional regulator, LysR family
pirR
Salt stress response transcriptional regulator, LysR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD