Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SahR in Desulfovibrio salexigens DSM 2638

Properties
Regulator type: Transcription factor
TF locus tag: Desal_3078
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Regulog: SahR - Desulfovibrionales
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 31 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -111
Score: 4.8
Sequence: ATATGCAAATTTATTTATAT
Locus tag: Desal_1278
Name: metK
Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
metK
S-adenosylmethionine synthetase (EC 2.5.1.6)

Position: -282
Score: 4.8
Sequence: ATATAACAATATTTTTATAT
Position: -274
Score: 4.2
Sequence: ATATTTTTATATATTGAATT
Locus tag: Desal_0813
Name: metE
Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
Locus tag: Desal_0814
Name: metF
Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metE
5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
metF
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)

Position: -39
Score: 3.7
Sequence: ATATAAAGGTTTTGTTATGT
Locus tag: Desal_3078
Name: sahR
Funciton: Predicted regulator of methionine metabolism, ArsR family
Locus tag: Desal_3077
Name: ahcY
Funciton: Adenosylhomocysteinase (EC 3.3.1.1)
sahR
Predicted regulator of methionine metabolism, ArsR family
ahcY
Adenosylhomocysteinase (EC 3.3.1.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD