Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SahR in Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Properties
Regulator type: Transcription factor
TF locus tag: Ddes_0040
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Regulog: SahR - Desulfovibrionales
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 31 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -80
Score: 6.5
Sequence: ATATCAATTTATCTTGATAT
Locus tag: Ddes_2008
Name: metF
Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metF
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)

Position: -18
Score: 5.8
Sequence: ATATCACAATACCTTGATAT
Position: -10
Score: 4.2
Sequence: ATACCTTGATATGCAGATAT
Locus tag: Ddes_2286
Name: panC
Funciton: Pantoate--beta-alanine ligase (EC 6.3.2.1)
Locus tag: Ddes_2287
Name: metK
Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
panC
Pantoate--beta-alanine ligase (EC 6.3.2.1)
metK
S-adenosylmethionine synthetase (EC 2.5.1.6)

Position: -57
Score: 5.4
Sequence: ATATGCGGATAACTTGATAC
Position: -35
Score: 5
Sequence: GTATCAGCATAAATTGATTT
Locus tag: Ddes_0040
Name: sahR
Funciton: Predicted regulator of methionine metabolism, ArsR family
Locus tag: Ddes_0039
Name: ahcY
Funciton: Adenosylhomocysteinase (EC 3.3.1.1)
sahR
Predicted regulator of methionine metabolism, ArsR family
ahcY
Adenosylhomocysteinase (EC 3.3.1.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD