Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SahR in Desulfovibrio desulfuricans G20

Properties
Regulator type: Transcription factor
TF locus tag: Dde_3135
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Regulog: SahR - Desulfovibrionales
Statistics of regulated genes:
- Genes 8
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 31 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -18
Score: 5.9
Sequence: ATATGCGGATACATTGATAT
Locus tag: Dde_1498
Name: panC
Funciton: Pantoate--beta-alanine ligase (EC 6.3.2.1)
Locus tag: Dde_1497
Name: null
Funciton: Uncharacterized conserved protein
Locus tag: Dde_1496
Name: metK
Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
panC
Pantoate--beta-alanine ligase (EC 6.3.2.1)
Uncharacterized conserved protein
metK
S-adenosylmethionine synthetase (EC 2.5.1.6)

Position: 63
Score: 5.3
Sequence: ACATCAACTTTTCTTGATTC
Locus tag: Dde_3135
Name: sahR
Funciton: Predicted regulator of methionine metabolism, ArsR family
Locus tag: Dde_3134
Name: ahcY
Funciton: Adenosylhomocysteinase (EC 3.3.1.1)
sahR
Predicted regulator of methionine metabolism, ArsR family
ahcY
Adenosylhomocysteinase (EC 3.3.1.1)

Position: -293
Score: 4.4
Sequence: ATATTGATGAATCTTGATAT
Locus tag: Dde_2328
Name: metE
Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
metE
5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)

Position: -69
Score: 4.5
Sequence: ATATTACAATAGGTCGATAT
Position: -45
Score: 6.2
Sequence: ATATAAGGCTATCTTGATAT
Locus tag: Dde_2525
Name: metF
Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metF
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)

Position: -131
Score: 5.7
Sequence: TTATCAACTTAGTTTGATAT
Locus tag: Dde_2476
Name: metT
Funciton: Methionine transporter MetT
metT
Methionine transporter MetT
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD