Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SahR in Desulfohalobium retbaense DSM 5692

Properties
Regulator type: Transcription factor
TF locus tag: Dret_2302
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Regulog: SahR - Desulfovibrionales
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 31 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -172
Score: 4.7
Sequence: TTATCAACTTTTTCAGATAT
Locus tag: Dret_2302
Name: sahR
Funciton: Predicted regulator of methionine metabolism, ArsR family
Locus tag: Dret_2301
Name: ahcY
Funciton: Adenosylhomocysteinase (EC 3.3.1.1)
Locus tag: Dret_2300
Name: metK
Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
sahR
Predicted regulator of methionine metabolism, ArsR family
ahcY
Adenosylhomocysteinase (EC 3.3.1.1)
metK
S-adenosylmethionine synthetase (EC 2.5.1.6)

Position: -102
Score: 6.3
Sequence: ATATCAAAATATCTTGATAT
Locus tag: Dret_2255
Name: bhmT
Funciton: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
bhmT
Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD