Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraR in Paenibacillus sp. JDR-2

Properties
Regulator type: Transcription factor
TF locus tag: Pjdr2_4208
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Bacillales
Statistics of regulated genes:
- Genes 4
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 43 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -62
Score: 5.3
Sequence: AAACATGTACGTACAAGTGT
Locus tag: Pjdr2_4207
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)

Position: -83
Score: 5.6
Sequence: TAAGTTGTACGTACAACTTA
Locus tag: Pjdr2_2502
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araA
L-arabinose isomerase (EC 5.3.1.4)

Position: -100
Score: 4.8
Sequence: TCACATGTACATACAAGTTA
Locus tag: Pjdr2_4209
Name: araK
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: Pjdr2_4208
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization, GntR family
araK
Ribulokinase (EC 2.7.1.16)
araR
Transcriptional repressor of arabinoside utilization, GntR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD