Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraR in Geobacillus kaustophilus HTA426

Properties
Regulator type: Transcription factor
TF locus tag: GK1907
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Bacillales
Statistics of regulated genes:
- Genes 7
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 43 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -36
Score: 5.7
Sequence: TTAAATATACGTACAAATTT
Locus tag: GK1910
Name: araF
Funciton: L-arabinose-binding periplasmic protein precursor AraF (TC 3.A.1.2.2)
Locus tag: GK1909
Name: araG
Funciton: L-arabinose transport ATP-binding protein AraG (TC 3.A.1.2.2)
Locus tag: GK1908
Name: araH
Funciton: L-arabinose transport system permease protein (TC 3.A.1.2.2)
araF
L-arabinose-binding periplasmic protein precursor AraF (TC 3.A.1.2.2)
araG
L-arabinose transport ATP-binding protein AraG (TC 3.A.1.2.2)
araH
L-arabinose transport system permease protein (TC 3.A.1.2.2)

Position: -75
Score: 5
Sequence: ATAATGATACGGACAAATAA
Locus tag: GK1907
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization, GntR family
araR
Transcriptional repressor of arabinoside utilization, GntR family

Position: -61
Score: 5.6
Sequence: AAAATTGTACGTACAATAGT
Locus tag: GK1906
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: GK1905
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: GK1904
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araB
Ribulokinase (EC 2.7.1.16)
araA
L-arabinose isomerase (EC 5.3.1.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD