Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraR in Bacillus subtilis subsp. subtilis str. 168

Properties
Regulator type: Transcription factor
TF locus tag: BSU33970
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Bacillales
Statistics of regulated genes:
- Genes 13
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 43 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -190
Score: 5.3
Sequence: AAATGTATACGGACAAATTT
Position: -109
Score: 6
Sequence: ATATTTGTACGTACTAATTA
Position: -66
Score: 5.5
Sequence: ATATAAGTACGTACAATTGA
Locus tag: BSU33960
Name: araE
Funciton: L-arabinose-proton symporter
araE
L-arabinose-proton symporter

Position: -159
Score: 5.2
Sequence: TTTTTTGTCTGTACAAATTA
Locus tag: BSU28810
Name: abnA
Funciton: Arabinan endo-1,5-alpha-L-arabinosidase (EC 3.2.1.99)
abnA
Arabinan endo-1,5-alpha-L-arabinosidase (EC 3.2.1.99)

Position: -91
Score: 5.5
Sequence: TCAATTGTACGTACTTATAT
Position: -48
Score: 6
Sequence: TAATTAGTACGTACAAATAT
Locus tag: BSU33970
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization, GntR family
araR
Transcriptional repressor of arabinoside utilization, GntR family

Position: -103
Score: 5.9
Sequence: AAAATTGTTCGTACAAATAT
Locus tag: BSU28800
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
Locus tag: BSU28790
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BSU28780
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BSU28770
Name: araL
Funciton: L-arabinose utilization protein
Locus tag: BSU28760
Name: egsA
Funciton: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
Locus tag: BSU28750
Name: araN
Funciton: Alpha-arabinosides ABC transport system, substrate-binding protein
Locus tag: BSU28740
Name: araP
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: BSU28730
Name: araQ
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: BSU28720
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araA
L-arabinose isomerase (EC 5.3.1.4)
araB
Ribulokinase (EC 2.7.1.16)
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araL
L-arabinose utilization protein
egsA
Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
araN
Alpha-arabinosides ABC transport system, substrate-binding protein
araP
Alpha-arabinosides ABC transport system, permease protein 1
araQ
Alpha-arabinosides ABC transport system, permease protein 2
abfA
Alpha-N-arabinofuranosidase (EC 3.2.1.55)

Position: -173
Score: 5.5
Sequence: AAATACATACGTACAAATAT
Locus tag: BSU28510
Name: xsa
Funciton: Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)
xsa
Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD