Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraR in Bacillus licheniformis DSM 13

Properties
Regulator type: Transcription factor
TF locus tag: BLi02061
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Bacillales
Statistics of regulated genes:
- Genes 13
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 43 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -138
Score: 5
Sequence: ATATTTATATGAACATATTA
Position: -106
Score: 5.8
Sequence: ACATATGTACGTACAAAAAA
Locus tag: BLi02062
Name: araK
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BLi02063
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BLi02064
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
Locus tag: BLi02065
Name: araE
Funciton: L-arabinose-proton symporter
araK
Ribulokinase (EC 2.7.1.16)
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araA
L-arabinose isomerase (EC 5.3.1.4)
araE
L-arabinose-proton symporter

Position: -155
Score: 5.2
Sequence: GAAGTTGTTCGTACAAATAT
Position: -125
Score: 5.7
Sequence: TTAGTTGTACGTACATATAA
Locus tag: BLi03028
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
Locus tag: BLi03027
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BLi03026
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BLi03025
Name: egsA
Funciton: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
Locus tag: BLi03024
Name: araN
Funciton: Alpha-arabinosides ABC transport system, substrate-binding protein
Locus tag: BLi03023
Name: araP
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: BLi03022
Name: araQ
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: BLi03021
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araA
L-arabinose isomerase (EC 5.3.1.4)
araB
Ribulokinase (EC 2.7.1.16)
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
egsA
Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
araN
Alpha-arabinosides ABC transport system, substrate-binding protein
araP
Alpha-arabinosides ABC transport system, permease protein 1
araQ
Alpha-arabinosides ABC transport system, permease protein 2
abfA
Alpha-N-arabinofuranosidase (EC 3.2.1.55)

Position: -192
Score: 5.8
Sequence: TTTTTTGTACGTACATATGT
Position: -160
Score: 5
Sequence: TAATATGTTCATATAAATAT
Locus tag: BLi02061
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization, GntR family
araR
Transcriptional repressor of arabinoside utilization, GntR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD