Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraR in Bacillus halodurans C-125

Properties
Regulator type: Transcription factor
TF locus tag: BH1875
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Bacillales
Statistics of regulated genes:
- Genes 12
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 43 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -198
Score: 6.1
Sequence: AAATTTGTACGTACAAAAAA
Position: -100
Score: 5.5
Sequence: TATTATGTACGTACAAGTTA
Locus tag: BH1861
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: BH1862
Name: egsA
Funciton: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
abfA
Alpha-N-arabinofuranosidase (EC 3.2.1.55)
egsA
Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)

Position: -71
Score: 5.7
Sequence: AAAATTGTACGTACAAGTGT
Locus tag: BH1871
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: BH1872
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: BH1873
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
Locus tag: BH1874
Name: xsa
Funciton: Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araB
Ribulokinase (EC 2.7.1.16)
araA
L-arabinose isomerase (EC 5.3.1.4)
xsa
Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)

Position: -36
Score: 5.2
Sequence: TCATTTGTACGTATAAGTTG
Locus tag: BH1875
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization, GntR family
araR
Transcriptional repressor of arabinoside utilization, GntR family

Position: -49
Score: 4.4
Sequence: AAACGTGTACGTACACGATA
Locus tag: BH0902
Name: araP
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: BH0903
Name: araQ
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: BH0904
Name: yteU
Funciton: Predicted integral membrane protein
Locus tag: BH0905
Name: araN
Funciton: Alpha-arabinosides ABC transport system, substrate-binding protein
araP
Alpha-arabinosides ABC transport system, permease protein 1
araQ
Alpha-arabinosides ABC transport system, permease protein 2
yteU
Predicted integral membrane protein
araN
Alpha-arabinosides ABC transport system, substrate-binding protein

Position: -172
Score: 5.6
Sequence: TTATTCGTACGAACAAATAA
Locus tag: BH1061
Name: BH1061
Funciton: Alpha-glucuronidase (EC 3.2.1.139)
BH1061
Alpha-glucuronidase (EC 3.2.1.139)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD