Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraR in Anoxybacillus flavithermus WK1

Properties
Regulator type: Transcription factor
TF locus tag: Aflv_0528
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Bacillales
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 43 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -81
Score: 5.9
Sequence: AAATATATACGTACAAATAA
Locus tag: Aflv_0528
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization, GntR family
araR
Transcriptional repressor of arabinoside utilization, GntR family

Position: -54
Score: 5.7
Sequence: AAAAATGTACGTACAAAATT
Locus tag: Aflv_0529
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: Aflv_0530
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: Aflv_0531
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
Locus tag: Aflv_0532
Name: abf5
Funciton: Alpha-L-arabinofuranosidase II precursor
Locus tag: Aflv_0533
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araB
Ribulokinase (EC 2.7.1.16)
araA
L-arabinose isomerase (EC 5.3.1.4)
abf5
Alpha-L-arabinofuranosidase II precursor
abfA
Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD