Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GudR in Oceanobacillus iheyensis HTE831

Properties
Regulator type: Transcription factor
TF locus tag: OB2842
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucarate utilization; Galactarate utilization
Effector:
Regulog: GudR - Bacillales
Statistics of regulated genes:
- Genes 7
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -90
Score: 6.6
Sequence: TTTATTTGTCGGACAAATAAA
Locus tag: OB2842
Name: gudR
Funciton: Transcriptional regulator for glucarate/galactarate utilization, GntR family
Locus tag: OB2841
Name: kdgD
Funciton: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
Locus tag: OB2840
Name: kgsD
Funciton: Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26)
Locus tag: OB2839
Name: tctB_Gud
Funciton: Tripartite tricarboxylate transporter family small permease component, putative transporter for glucarate
Locus tag: OB2838
Name: tctA_Gud
Funciton: Tripartite tricarboxylate transporter family large permease component, putative transporter for glucarate
Locus tag: OB2837
Name: tctC_Gud
Funciton: Tripartite tricarboxylate transporter family receptor, putative transporter for glucarate
Locus tag: OB2836
Name: gudD
Funciton: Glucarate dehydratase (EC 4.2.1.40)
gudR
Transcriptional regulator for glucarate/galactarate utilization, GntR family
kdgD
5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
kgsD
Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26)
tctB_Gud
Tripartite tricarboxylate transporter family small permease component, putative transporter for glucarate
tctA_Gud
Tripartite tricarboxylate transporter family large permease component, putative transporter for glucarate
tctC_Gud
Tripartite tricarboxylate transporter family receptor, putative transporter for glucarate
gudD
Glucarate dehydratase (EC 4.2.1.40)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD