Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GudR in Bacillus subtilis subsp. subtilis str. 168

Properties
Regulator type: Transcription factor
TF locus tag: BSU02500
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucarate utilization; Galactarate utilization
Effector:
Regulog: GudR - Bacillales
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -42
Score: 5.5
Sequence: CTATTTTGTCTTACAATTGAA
Locus tag: BSU02500
Name: gudR
Funciton: Transcriptional regulator for glucarate/galactarate utilization, GntR family
Locus tag: BSU02510
Name: garD
Funciton: D-galactarate dehydratase (EC 4.2.1.42)
gudR
Transcriptional regulator for glucarate/galactarate utilization, GntR family
garD
D-galactarate dehydratase (EC 4.2.1.42)

Position: -117
Score: 7
Sequence: TTTATTTGTCTTACAATTAAA
Locus tag: BSU02460
Name: kdgD
Funciton: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
Locus tag: BSU02470
Name: kgsD
Funciton: Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26)
Locus tag: BSU02480
Name: gudP
Funciton: Glucarate/galactarate transporter
Locus tag: BSU02490
Name: gudD
Funciton: Glucarate dehydratase (EC 4.2.1.40)
kdgD
5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
kgsD
Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26)
gudP
Glucarate/galactarate transporter
gudD
Glucarate dehydratase (EC 4.2.1.40)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD