Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GudR in Bacillus clausii KSM-K16

Properties
Regulator type: Transcription factor
TF locus tag: ABC0472
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucarate utilization; Galactarate utilization
Effector:
Regulog: GudR - Bacillales
Statistics of regulated genes:
- Genes 7
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -51
Score: 6.5
Sequence: TTAATTTGTCTTACAATAAAA
Locus tag: ABC0471
Name: kdgD
Funciton: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
Locus tag: ABC0470
Name: kgsD
Funciton: Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26)
Locus tag: ABC0469
Name: tctB_Gud
Funciton: Tripartite tricarboxylate transporter family small permease component, putative transporter for glucarate
Locus tag: ABC0468
Name: tctA_Gud
Funciton: Tripartite tricarboxylate transporter family large permease component, putative transporter for glucarate
Locus tag: ABC0467
Name: tctC_Gud
Funciton: Tripartite tricarboxylate transporter family receptor, putative transporter for glucarate
kdgD
5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
kgsD
Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26)
tctB_Gud
Tripartite tricarboxylate transporter family small permease component, putative transporter for glucarate
tctA_Gud
Tripartite tricarboxylate transporter family large permease component, putative transporter for glucarate
tctC_Gud
Tripartite tricarboxylate transporter family receptor, putative transporter for glucarate

Position: -63
Score: 5.9
Sequence: CCTATTTGTATTACAATTAAA
Locus tag: ABC0472
Name: gudR
Funciton: Transcriptional regulator for glucarate/galactarate utilization, GntR family
gudR
Transcriptional regulator for glucarate/galactarate utilization, GntR family

Position: -50
Score: 5.9
Sequence: TCTATTTGTCTTACAATTAAT
Locus tag: ABC0466
Name: ABC0466
Funciton: Putative mannonate dehydratase (EC 4.2.1.8)
ABC0466
Putative mannonate dehydratase (EC 4.2.1.8)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD