Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SufR in Thermosynechococcus elongatus BP-1

Properties
Regulator type: Transcription factor
TF locus tag: tlr0491
Regulator family: [Other]
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: SufR - Cyanobacteria
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -116
Score: 5.5
Sequence: TAAAACAACCGTTTTGTTGCTAAA
Position: -78
Score: 5.2
Sequence: TAAAGCAACCATCTCGTTGCTTAA
Locus tag: null
Name: sufB
Funciton: Iron-sulfur assembly protein
sufB
Iron-sulfur assembly protein

Position: -78
Score: 5.7
Sequence: TTAAGCAACGAGATGGTTGCTTTA
Position: -40
Score: 5.9
Sequence: TTTAGCAACAAAACGGTTGTTTTA
Locus tag: tlr0491
Name: sufR
Funciton: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
sufR
Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD