Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SufR in Synechocystis sp. PCC 6803

Properties
Regulator type: Transcription factor
TF locus tag: sll0088
Regulator family: [Other]
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: SufR - Cyanobacteria
Statistics of regulated genes:
- Genes 6
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -163
Score: 5.6
Sequence: TAAAACAACAGGTAAGTTGTTTTA
Position: -123
Score: 5.6
Sequence: ATTAGCAACCCGATTGTTGTCAAA
Locus tag: sll0088
Name: sufR
Funciton: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
sufR
Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria

Position: -172
Score: 4.9
Sequence: AAAAACAATCTTGACGTTGTTTAA
Locus tag: sll0741
Name: nifJ
Funciton: Pyruvate oxidoreductase
nifJ
Pyruvate oxidoreductase

Position: -116
Score: 5.3
Sequence: TAAAACAACTTACCTGTTGTTTTA
Locus tag: slr0074
Name: sufB
Funciton: Iron-sulfur assembly protein
Locus tag: slr0075
Name: sufC
Funciton: Iron-sulfur assembly ATPase
Locus tag: slr0076
Name: sufD
Funciton: Iron-sulfur assembly protein
Locus tag: slr0077
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
sufB
Iron-sulfur assembly protein
sufC
Iron-sulfur assembly ATPase
sufD
Iron-sulfur assembly protein
sufS
Cysteine desulfurase (EC 2.8.1.7)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD