Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SufR in Synechococcus elongatus PCC 7942

Properties
Regulator type: Transcription factor
TF locus tag: Synpcc7942_1733
Regulator family: [Other]
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: SufR - Cyanobacteria
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -136
Score: 5.7
Sequence: TTGAACAACACAGACGTTGCTTAA
Position: -98
Score: 5.7
Sequence: TTGAACAACATCAATGTTGTCAAA
Locus tag: Synpcc7942_1733
Name: sufR
Funciton: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
sufR
Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria

Position: -101
Score: 5.1
Sequence: TTTGACAACATTGATGTTGTTCAA
Position: -63
Score: 5.1
Sequence: TTAAGCAACGTCTGTGTTGTTCAA
Locus tag: Synpcc7942_1734
Name: ftrC
Funciton: Ferredoxin thioredoxin reductase catalytic chain
Locus tag: Synpcc7942_1735
Name: sufB
Funciton: Iron-sulfur assembly protein
Locus tag: Synpcc7942_1736
Name: sufC
Funciton: Iron-sulfur assembly ATPase
Locus tag: Synpcc7942_1737
Name: sufD
Funciton: Iron-sulfur assembly protein
Locus tag: Synpcc7942_1738
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
ftrC
Ferredoxin thioredoxin reductase catalytic chain
sufB
Iron-sulfur assembly protein
sufC
Iron-sulfur assembly ATPase
sufD
Iron-sulfur assembly protein
sufS
Cysteine desulfurase (EC 2.8.1.7)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD