Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SufR in Cyanothece sp. PCC 8801

Properties
Regulator type: Transcription factor
TF locus tag: PCC8801_0414
Regulator family: [Other]
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: SufR - Cyanobacteria
Statistics of regulated genes:
- Genes 6
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -200
Score: 5.7
Sequence: TTAAACAACATTTTTGTTGCTCAA
Position: -160
Score: 5.6
Sequence: AATAACAACCCCATTGTTGTCAAA
Locus tag: PCC8801_0414
Name: sufR
Funciton: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
sufR
Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria

Position: -134
Score: 5.5
Sequence: AAAAACAACCATGAAGTTGTCTTA
Locus tag: PCC8801_3918
Name: nifJ
Funciton: Pyruvate oxidoreductase
nifJ
Pyruvate oxidoreductase

Position: -188
Score: 4.8
Sequence: TTTGACAACAATGGGGTTGTTATT
Position: -148
Score: 5.9
Sequence: TTGAGCAACAAAAATGTTGTTTAA
Locus tag: PCC8801_0415
Name: sufB
Funciton: Iron-sulfur assembly protein
Locus tag: PCC8801_0416
Name: sufC
Funciton: Iron-sulfur assembly ATPase
Locus tag: PCC8801_0417
Name: sufD
Funciton: Iron-sulfur assembly protein
Locus tag: PCC8801_0418
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
sufB
Iron-sulfur assembly protein
sufC
Iron-sulfur assembly ATPase
sufD
Iron-sulfur assembly protein
sufS
Cysteine desulfurase (EC 2.8.1.7)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD