Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SufR in Cyanothece sp. PCC 7425

Properties
Regulator type: Transcription factor
TF locus tag: Cyan7425_3451
Regulator family: [Other]
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: SufR - Cyanobacteria
Statistics of regulated genes:
- Genes 10
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -113
Score: 5.5
Sequence: TTAAACAACTCAGGCGTTGCTTAA
Position: -74
Score: 5.8
Sequence: TTTAGCAACACATCAGTTGTCTAA
Locus tag: Cyan7425_3451
Name: sufR
Funciton: Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria
sufR
Iron-sulfur cluster biogenesis regulator SufR in Cyanobacteria

Position: -106
Score: 5
Sequence: TTAGACAACTGATGTGTTGCTAAA
Position: -67
Score: 5.3
Sequence: TTAAGCAACGCCTGAGTTGTTTAA
Locus tag: Cyan7425_3450
Name: sufB
Funciton: Iron-sulfur assembly protein
Locus tag: Cyan7425_3449
Name: null
Funciton: Hypothetical protein
Locus tag: Cyan7425_3448
Name: null
Funciton: Hypothetical protein
Locus tag: Cyan7425_3447
Name: null
Funciton: Hypothetical protein
Locus tag: Cyan7425_3446
Name: Cyan7425_3446
Funciton: Predicted oxoglutarate/iron-dependent oxygenase
Locus tag: Cyan7425_3445
Name: Cyan7425_3445
Funciton: Conserved hypothetical protein
Locus tag: Cyan7425_3444
Name: sufC
Funciton: Iron-sulfur assembly ATPase
Locus tag: Cyan7425_3443
Name: sufD
Funciton: Iron-sulfur assembly protein
Locus tag: Cyan7425_3442
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
sufB
Iron-sulfur assembly protein
Hypothetical protein
Hypothetical protein
Hypothetical protein
Cyan7425_3446
Predicted oxoglutarate/iron-dependent oxygenase
Cyan7425_3445
Conserved hypothetical protein
sufC
Iron-sulfur assembly ATPase
sufD
Iron-sulfur assembly protein
sufS
Cysteine desulfurase (EC 2.8.1.7)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD