Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IolR in Bacillus subtilis subsp. subtilis str. 168

Properties
Regulator type: Transcription factor
TF locus tag: BSU39770
Regulator family: DeoR
Regulation mode: repressor
Biological process: Inositol utilization
Effector: 2-deoxy-5-keto-D-gluconate 6-phosphate
Regulog: IolR - Bacillales
Statistics of regulated genes:
- Genes 12
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -69
Score: -1.5
Sequence: ACTATTGATTAACTTTTGGTTT
Locus tag: BSU39770
Name: iolR
Funciton: Transcriptional regulator of myo-inositol utilization, DeoR family
Locus tag: BSU39780
Name: iolS
Funciton: Oxidoreductase
iolR
Transcriptional regulator of myo-inositol utilization, DeoR family
iolS
Oxidoreductase

Position: -196
Score: 6.4
Sequence: TAACCAAGAAATGACCAAAAAG
Locus tag: BSU39760
Name: iolA
Funciton: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
Locus tag: BSU39750
Name: iolB
Funciton: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
Locus tag: BSU39740
Name: iolC
Funciton: 5-keto-2-deoxygluconokinase (EC 2.7.1.92)
Locus tag: BSU39730
Name: iolD
Funciton: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
Locus tag: BSU39720
Name: iolE
Funciton: Inosose dehydratase (EC 4.2.1.44)
Locus tag: BSU39710
Name: iolF
Funciton: Minor myo-inositol transporter IolF
Locus tag: BSU39700
Name: iolG
Funciton: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
Locus tag: BSU39690
Name: iolH
Funciton: putative sugar-phosphate epimerase/isomerase IolH
Locus tag: BSU39680
Name: iolI
Funciton: Inosose isomerase (EC 5.3.99.-)
Locus tag: BSU39670
Name: iolJ
Funciton: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
iolA
Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
iolB
5-deoxy-glucuronate isomerase (EC 5.3.1.-)
iolC
5-keto-2-deoxygluconokinase (EC 2.7.1.92)
iolD
3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
iolE
Inosose dehydratase (EC 4.2.1.44)
iolF
Minor myo-inositol transporter IolF
iolG
Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
iolH
putative sugar-phosphate epimerase/isomerase IolH
iolI
Inosose isomerase (EC 5.3.99.-)
iolJ
5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD