Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IolR in Bacillus clausii KSM-K16

Properties
Regulator type: Transcription factor
TF locus tag: ABC0421
Regulator family: DeoR
Regulation mode: repressor
Biological process: Inositol utilization
Effector: 2-deoxy-5-keto-D-gluconate 6-phosphate
Regulog: IolR - Bacillales
Statistics of regulated genes:
- Genes 10
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -66
Score: 5.9
Sequence: TAACCAACAAATGATCAAAAAG
Locus tag: ABC0422
Name: iolA
Funciton: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
Locus tag: ABC0423
Name: iolB
Funciton: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
Locus tag: ABC0424
Name: iolC
Funciton: 5-keto-2-deoxygluconokinase (EC 2.7.1.92)
Locus tag: ABC0425
Name: iolD
Funciton: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
Locus tag: ABC0426
Name: iolE
Funciton: Inosose dehydratase (EC 4.2.1.44)
Locus tag: ABC0427
Name: iolG
Funciton: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
Locus tag: ABC0428
Name: iolJ
Funciton: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
Locus tag: ABC0429
Name: iolX
Funciton: Scyllo-inositol dehydrogenase (EC 1.1.1.-)
Locus tag: ABC0430
Name: null
Funciton: Na+:myo-inositol cotransporter
iolA
Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
iolB
5-deoxy-glucuronate isomerase (EC 5.3.1.-)
iolC
5-keto-2-deoxygluconokinase (EC 2.7.1.92)
iolD
3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
iolE
Inosose dehydratase (EC 4.2.1.44)
iolG
Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
iolJ
5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
iolX
Scyllo-inositol dehydrogenase (EC 1.1.1.-)
Na+:myo-inositol cotransporter

Position: -160
Score: -2
Sequence: CTTTTTGATCATTTGTTGGTTA
Locus tag: ABC0421
Name: iolR
Funciton: Transcriptional regulator of myo-inositol utilization, DeoR family
iolR
Transcriptional regulator of myo-inositol utilization, DeoR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD