Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of YiaJ in Salmonella typhimurium LT2

Properties
Regulator type: Transcription factor
TF locus tag: STM3667
Regulator family: IclR
Regulation mode: repressor
Biological process: L-lyxose utilization
Effector: Ascorbate-6-phosphate
Regulog: YiaJ - Enterobacteriales
Statistics of regulated genes:
- Genes 11
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -82
Score: 6
Sequence: ATTTGGAACTAGATTTCGCAT
Locus tag: STM3668
Name: yiaK
Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Locus tag: STM3669
Name: yiaL
Funciton: hypothetical protein
Locus tag: STM3670
Name: cheX
Funciton: putative chemotaxis protein
Locus tag: STM3671
Name: yiaM
Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit
Locus tag: STM3672
Name: yiaN
Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit
Locus tag: STM3673
Name: yiaO
Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein
Locus tag: STM3674
Name: lyxK
Funciton: L-xylulose kinase
Locus tag: STM3675
Name: sgbH
Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase
Locus tag: STM3676
Name: sgbU
Funciton: putative 3-hexulose-6-phosphate isomerase
Locus tag: STM3677
Name: sgbE
Funciton: L-ribulose-5-phosphate 4-epimerase
yiaK
2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
yiaL
hypothetical protein
cheX
putative chemotaxis protein
yiaM
predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit
yiaN
predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit
yiaO
predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein
lyxK
L-xylulose kinase
sgbH
3-keto-L-gulonate 6-phosphate decarboxylase
sgbU
putative 3-hexulose-6-phosphate isomerase
sgbE
L-ribulose-5-phosphate 4-epimerase

Position: -168
Score: 6.2
Sequence: ATGCGAAATCTAGTTCCAAAT
Locus tag: STM3667
Name: yiaJ
Funciton: transcriptional regulator of L-lyxose catabolism, IclR family
yiaJ
transcriptional regulator of L-lyxose catabolism, IclR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD