Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of YiaJ in Citrobacter koseri ATCC BAA-895

Properties
Regulator type: Transcription factor
TF locus tag: CKO_05032
Regulator family: IclR
Regulation mode: repressor
Biological process: L-lyxose utilization
Effector: Ascorbate-6-phosphate
Regulog: YiaJ - Enterobacteriales
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -72
Score: 6.5
Sequence: ATTTGAAATCAGATTTCGCAT
Locus tag: CKO_05033
Name: yiaK
Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Locus tag: CKO_05034
Name: yiaL
Funciton: hypothetical protein
Locus tag: CKO_05035
Name: cheX
Funciton: putative chemotaxis protein
Locus tag: CKO_05036
Name: sgbT
Funciton: predicted 3-dehydro-L-gulonate MFS transporter
Locus tag: CKO_05037
Name: lyxK
Funciton: L-xylulose kinase
yiaK
2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
yiaL
hypothetical protein
cheX
putative chemotaxis protein
sgbT
predicted 3-dehydro-L-gulonate MFS transporter
lyxK
L-xylulose kinase

Position: -167
Score: 6.5
Sequence: ATGCGAAATCTGATTTCAAAT
Locus tag: CKO_05032
Name: yiaJ
Funciton: transcriptional regulator of L-lyxose catabolism, IclR family
yiaJ
transcriptional regulator of L-lyxose catabolism, IclR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD