Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ZntR in Proteus mirabilis HI4320

Properties
Regulator type: Transcription factor
TF locus tag: PMI3282
Regulator family: MerR
Regulation mode: activator
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Regulog: ZntR - Enterobacteriales
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -74
Score: 6.5
Sequence: ACTCTGGACTCTACTCCAAGCT
Locus tag: PMI3600
Name: zntA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
zntA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD