Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PhhR in Pseudomonas stutzeri A1501

Properties
Regulator type: Transcription factor
TF locus tag: PST_3561
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Regulog: PhhR - Pseudomonadaceae
Statistics of regulated genes:
- Genes 9
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -203
Score: 4.8
Sequence: CTGTCAGCTTTTCGTTACGC
Position: -143
Score: 5.2
Sequence: CTGTAAGGAAAACCTGACAG
Locus tag: PST_0869
Name: hpd
Funciton: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
Locus tag: PST_0870
Name: hmgA
Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Locus tag: PST_0871
Name: hmgC
Funciton: Fumarylacetoacetase (EC 3.7.1.2)
Locus tag: PST_0872
Name: hmgB
Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
Locus tag: PST_0873
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
hpd
4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
hmgA
Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
hmgC
Fumarylacetoacetase (EC 3.7.1.2)
hmgB
Maleylacetoacetate isomerase (EC 5.2.1.2)
COG0733
Predicted 4-Hydroxyphenylpyruvate transporter, SNF family

Position: -136
Score: 4.9
Sequence: CTGTAAGAAATACATGACAG
Position: -74
Score: 5.4
Sequence: CTGTCAAATAATCTTGACGA
Locus tag: PST_3561
Name: phhR
Funciton: Phenylalanine degradation transcriptional activator, TyrR family
phhR
Phenylalanine degradation transcriptional activator, TyrR family

Position: -191
Score: 5.4
Sequence: TCGTCAAGATTATTTGACAG
Position: -129
Score: 4.9
Sequence: CTGTCATGTATTTCTTACAG
Locus tag: PST_3562
Name: phhA
Funciton: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Locus tag: PST_3563
Name: phhB
Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
Locus tag: PST_3564
Name: phhC
Funciton: Aromatic-amino-acid aminotransferase (EC 2.6.1.57)
phhA
Phenylalanine-4-hydroxylase (EC 1.14.16.1)
phhB
Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
phhC
Aromatic-amino-acid aminotransferase (EC 2.6.1.57)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD