Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PhhR in Pseudomonas putida KT2440

Properties
Regulator type: Transcription factor
TF locus tag: PP4489
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Regulog: PhhR - Pseudomonadaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -138
Score: 5.4
Sequence: TCGTAACGATAATTTTACAA
Position: -65
Score: 5.2
Sequence: TTGTCAGCTTATCTTTACGA
Locus tag: PP4489
Name: phhR
Funciton: Phenylalanine degradation transcriptional activator, TyrR family
phhR
Phenylalanine degradation transcriptional activator, TyrR family

Position: -212
Score: 5.2
Sequence: TCGTAAAGATAAGCTGACAA
Position: -139
Score: 5.4
Sequence: TTGTAAAATTATCGTTACGA
Locus tag: PP4490
Name: phhA
Funciton: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Locus tag: PP4491
Name: phhB
Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
phhA
Phenylalanine-4-hydroxylase (EC 1.14.16.1)
phhB
Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD