Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PhhR in Pseudomonas fluorescens Pf-5

Properties
Regulator type: Transcription factor
TF locus tag: PFL_1612
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Regulog: PhhR - Pseudomonadaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -194
Score: 5.5
Sequence: TTGTAAAGTAAACGTTACGA
Position: -120
Score: 5.3
Sequence: CTGTCACATAATCTTGACGA
Locus tag: PFL_1612
Name: phhR
Funciton: Phenylalanine degradation transcriptional activator, TyrR family
phhR
Phenylalanine degradation transcriptional activator, TyrR family

Position: -207
Score: 5.3
Sequence: TCGTCAAGATTATGTGACAG
Position: -133
Score: 5.5
Sequence: TCGTAACGTTTACTTTACAA
Locus tag: PFL_1611
Name: phhA
Funciton: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Locus tag: PFL_1610
Name: phhB
Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
Locus tag: PFL_1609
Name: phhC
Funciton: Aromatic-amino-acid aminotransferase (EC 2.6.1.57)
phhA
Phenylalanine-4-hydroxylase (EC 1.14.16.1)
phhB
Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
phhC
Aromatic-amino-acid aminotransferase (EC 2.6.1.57)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD