Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PhhR in Pseudomonas aeruginosa PAO1

Properties
Regulator type: Transcription factor
TF locus tag: PA0873
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Regulog: PhhR - Pseudomonadaceae
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -212
Score: 5.6
Sequence: CTGTAAAGATAACTTTACGA
Position: -161
Score: 4.4
Sequence: GCGTAAGGAATAGTTGCCAG
Locus tag: PA0865
Name: hpd
Funciton: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
hpd
4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)

Position: -159
Score: 5.5
Sequence: TCGTAAAGTTTTCCTTACGA
Position: -86
Score: 5.2
Sequence: CTGTCACATATTCTTGACGG
Locus tag: PA0873
Name: phhR
Funciton: Phenylalanine degradation transcriptional activator, TyrR family
phhR
Phenylalanine degradation transcriptional activator, TyrR family

Position: -217
Score: 5.2
Sequence: CCGTCAAGAATATGTGACAG
Position: -144
Score: 5.5
Sequence: TCGTAAGGAAAACTTTACGA
Locus tag: PA0872
Name: phhA
Funciton: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Locus tag: PA0871
Name: phhB
Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
Locus tag: PA0870
Name: phhC
Funciton: Aromatic-amino-acid aminotransferase (EC 2.6.1.57)
phhA
Phenylalanine-4-hydroxylase (EC 1.14.16.1)
phhB
Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
phhC
Aromatic-amino-acid aminotransferase (EC 2.6.1.57)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD