Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MarR in Enterobacter sp. 638

Properties
Regulator type: Transcription factor
TF locus tag: Ent638_1998
Regulator family: MarR
Regulation mode: repressor
Biological process: Antibiotic resistance
Effector: Salicylate; Tetracycline; Chloramphenicol
Regulog: MarR - Enterobacteriales
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -58
Score: 6.8
Sequence: TATACTTGCCTGAGCAATAATA
Position: -22
Score: 6.7
Sequence: ACTACTTGCCAGGGCAACCATT
Locus tag: Ent638_1998
Name: marR
Funciton: DNA-binding transcriptional repressor MarR
Locus tag: Ent638_1997
Name: marA
Funciton: DNA-binding transcriptional activator MarA
Locus tag: Ent638_1996
Name: marB
Funciton: multiple antibiotic resistance protein
marR
DNA-binding transcriptional repressor MarR
marA
DNA-binding transcriptional activator MarA
marB
multiple antibiotic resistance protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD