Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Thermosynechococcus elongatus BP-1

Properties
Regulator type: Transcription factor
TF locus tag: tlr0192
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Cyanobacteria
Statistics of regulated genes:
- Genes 4
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 84 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -84
Score: 6.2
Sequence: AGTAGAATGATAATCATTACAAT
Locus tag: tlr1246
Name: ompZ
Funciton: Predicted zink uptake outer membrane protein
ompZ
Predicted zink uptake outer membrane protein

Position: -36
Score: 5.7
Sequence: ATGAGAATGATTCTCTTTTTCTT
Locus tag: tlr2276
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
yciC
Putative zinc chaperone, COG0523 family

Position: -31
Score: 6.3
Sequence: ATGAGAATGATTATCATTCATCT
Locus tag: tlr2062
Name: znuA
Funciton: Zinc ABC transporter, substrate-binding protein
Locus tag: tlr2063
Name: znuB
Funciton: Zinc ABC transporter, ATP-binding protein
znuA
Zinc ABC transporter, substrate-binding protein
znuB
Zinc ABC transporter, ATP-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD