Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Prochlorococcus marinus str. MIT 9313

Properties
Regulator type: Transcription factor
TF locus tag: PMT2208
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Cyanobacteria
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 84 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -111
Score: 6
Sequence: ATGAGAATGATTCCCATTTTTAT
Locus tag: PMT2202
Name: cce_1485
Funciton: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
Locus tag: PMT2201
Name: cce_1486
Funciton: Predicted Mn/Zn chelate ABC transporter, permease protein
cce_1485
Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
cce_1486
Predicted Mn/Zn chelate ABC transporter, permease protein

Position: -34
Score: 6
Sequence: ATAAAAATGGGAATCATTCTCAT
Locus tag: PMT2203
Name: cce_1484
Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
cce_1484
Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD