Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Trichodesmium erythraeum IMS101

Properties
Regulator type: Transcription factor
TF locus tag: Tery_1953
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Cyanobacteria
Statistics of regulated genes:
- Genes 9
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 84 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -287
Score: 5.2
Sequence: ATTATAATCATATTTATTATTAA
Locus tag: Tery_3358
Name: cce_1484
Funciton: Predicted Mn/Zn chelate ABC transporter, permease protein
cce_1484
Predicted Mn/Zn chelate ABC transporter, permease protein

Position: -37
Score: 4.8
Sequence: AGGATAATGATTATTAAAATTGA
Locus tag: Tery_2490
Name: hisI2
Funciton: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
hisI2
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)

Position: -255
Score: 5.2
Sequence: ATTATGATAATAATTATTGCAAT
Locus tag: Tery_4617
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
Locus tag: Tery_4616
Name: folE2
Funciton: GTP cyclohydrolase I (EC 3.5.4.16)
yciC
Putative zinc chaperone, COG0523 family
folE2
GTP cyclohydrolase I (EC 3.5.4.16)

Position: -43
Score: 6.5
Sequence: AAAAGAATGATAATCATTCTTAA
Locus tag: Tery_4613
Name: PF07992
Funciton: Predicted FAD-dependent oxidoreductase, PF07992 family
PF07992
Predicted FAD-dependent oxidoreductase, PF07992 family

Position: -49
Score: 6.9
Sequence: AAAAGAATGATAATCATTATCAT
Locus tag: Tery_4951
Name: znuA
Funciton: Zinc ABC transporter, substrate-binding protein
Locus tag: Tery_4952
Name: znuB
Funciton: Zinc ABC transporter, ATP-binding protein
Locus tag: Tery_4953
Name: znuC
Funciton: Zinc ABC transporter, permease protein
znuA
Zinc ABC transporter, substrate-binding protein
znuB
Zinc ABC transporter, ATP-binding protein
znuC
Zinc ABC transporter, permease protein

Position: -84
Score: 4.3
Sequence: TTTGAAACAAGTATTATTGTTTT
Locus tag: Tery_4609
Name: alr1199
Funciton: Metal-dependent phosphatase
alr1199
Metal-dependent phosphatase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD