Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Cyanothece sp. ATCC 51142

Properties
Regulator type: Transcription factor
TF locus tag: cce_2881, cce_4859
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Cyanobacteria
Statistics of regulated genes:
- Genes 27
- Operons 17
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 84 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -40
Score: 6.7
Sequence: ACTAGAATGATTATCATTATCAT
Locus tag: cce_1484
Name: cce_1484
Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
cce_1484
Predicted Mn/Zn chelate ABC transporter, substrate-binding protein

Position: -31
Score: 6.7
Sequence: ATGATAATGATAATCATTCTAGT
Locus tag: cce_1485
Name: cce_1485
Funciton: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
Locus tag: cce_1486
Name: cce_1486
Funciton: Predicted Mn/Zn chelate ABC transporter, permease protein
cce_1485
Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
cce_1486
Predicted Mn/Zn chelate ABC transporter, permease protein

Position: -37
Score: 5.4
Sequence: ATGATAATGATTATCAAAATTGA
Locus tag: cce_4845
Name: hisI2
Funciton: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
hisI2
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)

Position: 28
Score: 6.3
Sequence: ATGATAATGATTATTATTACAAT
Locus tag: cce_4835
Name: thrS2
Funciton: Threonyl-tRNA synthetase (EC 6.1.1.3)
thrS2
Threonyl-tRNA synthetase (EC 6.1.1.3)

Position: 81
Score: 6.7
Sequence: TTGATAATGATTATCATTTTTAT
Position: 127
Score: 6.9
Sequence: ATAATAATGATTATCATTTTTAT
Locus tag: cce_1495
Name: thrS2
Funciton: Threonyl-tRNA synthetase (EC 6.1.1.3)
thrS2
Threonyl-tRNA synthetase (EC 6.1.1.3)

Position: -80
Score: 6.3
Sequence: ATTGTAATAATAATCATTATCAT
Position: -52
Score: 5.3
Sequence: CGTAAATTGATAATCATTATCAA
Locus tag: cce_4834
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
yciC
Putative zinc chaperone, COG0523 family

Position: -46
Score: 5.6
Sequence: TTAAGAACGATTATCGTTATAGT
Locus tag: cce_4833
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
yciC
Putative zinc chaperone, COG0523 family

Position: -43
Score: 5.4
Sequence: TTGAGAACGATTATCATTTTATC
Locus tag: cce_1501
Name: folE2
Funciton: GTP cyclohydrolase I (EC 3.5.4.16)
Locus tag: cce_1500
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
folE2
GTP cyclohydrolase I (EC 3.5.4.16)
yciC
Putative zinc chaperone, COG0523 family

Position: -78
Score: 7.1
Sequence: ATAATAATGATTATCATTATTAT
Position: -32
Score: 5.9
Sequence: ATAATAATGATTATCGTTTCTAA
Locus tag: cce_1489
Name: hemB2
Funciton: Porphobilinogen synthase (EC 4.2.1.24)
hemB2
Porphobilinogen synthase (EC 4.2.1.24)

Position: -72
Score: 6
Sequence: TAAATAATAATAATCATTCTCGT
Position: -46
Score: 6.6
Sequence: ATAATAATGATTATCATTTTGAT
Locus tag: cce_4852
Name: hemB2
Funciton: Porphobilinogen synthase (EC 4.2.1.24)
hemB2
Porphobilinogen synthase (EC 4.2.1.24)

Position: -62
Score: 6.4
Sequence: ATTAAAATGATAACCATTATTAT
Position: -36
Score: 6.1
Sequence: ATGAGAATGATTATCGTTAATTT
Locus tag: cce_4863
Name: PF07992
Funciton: Predicted FAD-dependent oxidoreductase, PF07992 family
PF07992
Predicted FAD-dependent oxidoreductase, PF07992 family

Position: -77
Score: 6.1
Sequence: TTGAGAATGATTATTATTCTTAA
Position: -38
Score: 6.2
Sequence: ATGAAAATGATTATCATTTTAGA
Locus tag: cce_1488
Name: yciC2
Funciton: Putative zinc chaperone, COG0523 family
Locus tag: cce_1487
Name: COG2319
Funciton: WD-40 repeat-containing protein, COG2319 family
yciC2
Putative zinc chaperone, COG0523 family
COG2319
WD-40 repeat-containing protein, COG2319 family

Position: -50
Score: 5.8
Sequence: ATGAGATCAATTATCATTATCAT
Locus tag: cce_4857
Name: yciC2
Funciton: Putative zinc chaperone, COG0523 family
Locus tag: cce_4858
Name: COG2319
Funciton: WD-40 repeat-containing protein, COG2319 family
yciC2
Putative zinc chaperone, COG0523 family
COG2319
WD-40 repeat-containing protein, COG2319 family

Position: -72
Score: 6.1
Sequence: AAATTAACGATAATCATTCTCAT
Position: -46
Score: 6.4
Sequence: ATAATAATGGTTATCATTTTAAT
Locus tag: cce_4862
Name: znuA
Funciton: Zinc ABC transporter, substrate-binding protein
Locus tag: cce_4861
Name: znuB
Funciton: Zinc ABC transporter, ATP-binding protein
Locus tag: cce_4860
Name: znuC
Funciton: Zinc ABC transporter, permease protein
znuA
Zinc ABC transporter, substrate-binding protein
znuB
Zinc ABC transporter, ATP-binding protein
znuC
Zinc ABC transporter, permease protein

Position: -79
Score: 5.6
Sequence: TTAATAGTGATAATGATTCTTAT
Locus tag: cce_2961
Name: znuA
Funciton: Zinc ABC transporter, substrate-binding protein
Locus tag: cce_2962
Name: znuB
Funciton: Zinc ABC transporter, ATP-binding protein
Locus tag: cce_2963
Name: znuC
Funciton: Zinc ABC transporter, permease protein
znuA
Zinc ABC transporter, substrate-binding protein
znuB
Zinc ABC transporter, ATP-binding protein
znuC
Zinc ABC transporter, permease protein

Position: -120
Score: 6
Sequence: ATAATAATGATTATTATTCTACA
Locus tag: cce_4859
Name: zur
Funciton: Zinc uptake transcription regulator, Fur family
zur
Zinc uptake transcription regulator, Fur family

Position: -6
Score: 4.7
Sequence: CTAACAATGATTACTGTAATTAT
Locus tag: cce_1494
Name: alr1197
Funciton: Putative metallochaperone, similar to COG0523 family
Locus tag: cce_1493
Name: alr1198
Funciton: Metallophosphoesterase, COG0622 family
Locus tag: cce_1492
Name: alr1199
Funciton: Metal-dependent phosphatase
alr1197
Putative metallochaperone, similar to COG0523 family
alr1198
Metallophosphoesterase, COG0622 family
alr1199
Metal-dependent phosphatase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD