Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Synechocystis sp. PCC 6803

Properties
Regulator type: Transcription factor
TF locus tag: sll1937
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Cyanobacteria
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 84 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -118
Score: 6.7
Sequence: ATGATAATGATTATCATTATTTA
Locus tag: sll1550
Name: ompZ
Funciton: Predicted zink uptake outer membrane protein
ompZ
Predicted zink uptake outer membrane protein

Position: -84
Score: 5.6
Sequence: ATGATAATGATTATCGTTTATTG
Locus tag: slr2043
Name: znuA
Funciton: Zinc ABC transporter, substrate-binding protein
Locus tag: slr2044
Name: znuB
Funciton: Zinc ABC transporter, ATP-binding protein
Locus tag: slr2045
Name: znuC
Funciton: Zinc ABC transporter, permease protein
znuA
Zinc ABC transporter, substrate-binding protein
znuB
Zinc ABC transporter, ATP-binding protein
znuC
Zinc ABC transporter, permease protein

Position: -45
Score: 5.6
Sequence: CAATAAACGATAATCATTATCAT
Locus tag: sll1937
Name: zur
Funciton: Zinc uptake transcription regulator, Fur family
zur
Zinc uptake transcription regulator, Fur family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD