Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NrtR in Trichodesmium erythraeum IMS101

Properties
Regulator type: Transcription factor
TF locus tag: Tery_0320
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Cyanobacteria
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -85
Score: 4.6
Sequence: TTATAGTATAATTCATCAAAC
Locus tag: Tery_2446
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
nadA
Quinolinate synthetase (EC 4.1.99.-)

Position: -173
Score: 5.9
Sequence: ATATAGTAAGAATAACTATAA
Locus tag: Tery_0318
Name: pncB
Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
pncB
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD