Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NrtR in Cyanothece sp. ATCC 51142

Properties
Regulator type: Transcription factor
TF locus tag: cce_2757
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Cyanobacteria
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -24
Score: 5.8
Sequence: TTTTGGTAAGATCAACTATAA
Locus tag: cce_3716
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
nadA
Quinolinate synthetase (EC 4.1.99.-)

Position: -49
Score: 5.9
Sequence: TTTTGGTAAAAGTTACTATAA
Locus tag: cce_2759
Name: pncB
Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Locus tag: cce_2758
Name: nadD
Funciton: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
Locus tag: cce_2757
Name: nrtR
Funciton: Nudix-related transcriptional regulator NrtR
Locus tag: cce_2756
Name: nadE
Funciton: NAD synthetase (EC 6.3.1.5)
pncB
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
nadD
Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
nrtR
Nudix-related transcriptional regulator NrtR
nadE
NAD synthetase (EC 6.3.1.5)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD