Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NrtR in Synechocystis sp. PCC 6803

Properties
Regulator type: Transcription factor
TF locus tag: slr1690
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Cyanobacteria
Statistics of regulated genes:
- Genes 4
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -69
Score: 6
Sequence: TTTTGGTGAAATCTACTATAA
Locus tag: slr0787
Name: nadM
Funciton: Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
Locus tag: slr0788
Name: nadV
Funciton: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
nadM
Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
nadV
Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)

Position: -34
Score: 6
Sequence: TTAAAGTAATAATTACCATAA
Locus tag: slr1691
Name: nadE
Funciton: NAD synthetase (EC 6.3.1.5)
nadE
NAD synthetase (EC 6.3.1.5)

Position: -43
Score: 6.1
Sequence: TTATGGTAGTTTTAACTATAA
Locus tag: sll0622
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
nadA
Quinolinate synthetase (EC 4.1.99.-)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD