Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LacI in Erwinia carotovora subsp. atroseptica SCRI1043

Properties
Regulator type: Transcription factor
TF locus tag: ECA1491
Regulator family: LacI
Regulation mode: repressor
Biological process: Lactose utilization
Effector: Allolactose
Regulog: LacI - Enterobacteriales
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -73
Score: 7.4
Sequence: AATTGTGAGCGGATAACAATT
Locus tag: ECA1490
Name: lacZ
Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: ECA1489
Name: lacY
Funciton: Lactose permease, MFS family
lacZ
Beta-galactosidase (EC 3.2.1.23)
lacY
Lactose permease, MFS family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD