Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LacI in Citrobacter koseri ATCC BAA-895

Properties
Regulator type: Transcription factor
TF locus tag: CKO_02824
Regulator family: LacI
Regulation mode: repressor
Biological process: Lactose utilization
Effector: Allolactose
Regulog: LacI - Enterobacteriales
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -38
Score: 7
Sequence: AATTGTGAGCGAATAACAAAC
Locus tag: CKO_02825
Name: lacZ
Funciton: Beta-galactosidase (EC 3.2.1.23)
lacZ
Beta-galactosidase (EC 3.2.1.23)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD